Stem-loop sequence tca-mir-3883

AccessionMI0016379 (change log)
DescriptionTribolium castaneum miR-3883 stem-loop
Stem-loop
   u  uc   u    acc  c     c   -     cg 
5'  uc  cca aaga   cu guuag gag uuugg  a
    ||  ||| ||||   || ||||| ||| |||||  a
3'  ag  ggu uucu   ga caauu cuc aaacc  g
   u  gu   -    -ac  -     u   c     uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped228: 8917-8987 [+]
intergenic
Database links

Mature sequence tca-miR-3883-5p

Accession MIMAT0018862
Sequence

9 - 

uaagaacccucguuagcgaguuuggc

 - 34

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3883-3p

Accession MIMAT0018863
Sequence

40 - 

uccaaaccucuuuaacagcaucuuug

 - 65

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).