Stem-loop sequence tca-mir-3882

AccessionMI0016378 (change log)
DescriptionTribolium castaneum miR-3882 stem-loop
Stem-loop
   ucucc  a -u  aca         -------   a       guu 
5'      gc c  ug   caucggugu       ucu ccaugca   c
        || |  ||   |||||||||       ||| |||||||   c
3'      cg g  ac   guagccaca       aga ggugcgu   u
   uuugu  a uc  --g         aucgcua   a       guc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped29: 14499-14583 [-]
intergenic
Database links

Mature sequence tca-miR-3882-5p

Accession MIMAT0018860
Sequence

10 - 

uugacacaucgguguucuaccaugca

 - 35

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3882-3p

Accession MIMAT0018861
Sequence

49 - 

uggaagaaucgcuaacaccgauggca

 - 74

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).