Stem-loop sequence tca-mir-3881

AccessionMI0016377 (change log)
DescriptionTribolium castaneum miR-3881 stem-loop
Stem-loop
   acgc    uc      uuu      uguu   ucu    gau       
5'     agac  uucgag   aaauua    gag   uucc   agcgau 
       ||||  ||||||   ||||||    |||   ||||   ||||| c
3'     ucug  aggcuc   uuuaau    uuc   aggg   ucguuu 
   cuuu    -u      ---      ----   --u    auu       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG10: 1879159-1879245 [-]
intergenic
Database links

Mature sequence tca-miR-3881-5p

Accession MIMAT0018858
Sequence

12 - 

ucgaguuuaaauuauguugagucuuu

 - 37

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3881-3p

Accession MIMAT0018859
Sequence

52 - 

ugcuuuagggaucuuuaauuucucgg

 - 77

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).