Stem-loop sequence tca-mir-3880

AccessionMI0016376 (change log)
DescriptionTribolium castaneum miR-3880 stem-loop
Stem-loop
   cuuca ug  uc   g aa   aa   u   g       -ug    cu  gu   
5'      u  gg  caa a  cga  gaa ucg cgauuuu   uccu  ga  cu 
        |  ||  ||| |  |||  ||| ||| |||||||   ||||  ||  | u
3'      a  cc  guu u  gcu  cuu agc guuagag   aggg  cu  ga 
   cauaa gu  -u   g -a   gc   c   -       uua    -c  ug   
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped36: 42421-42524 [+]
intergenic
Database links

Mature sequence tca-miR-3880-5p

Accession MIMAT0018856
Sequence

11 - 

uccaagaaacgaaagaauucg

 - 31

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3880-3p

Accession MIMAT0018857
Sequence

74 - 

ugcgacuuccgucgauguuguccuga

 - 99

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).