Stem-loop sequence tca-mir-11

AccessionMI0016375 (change log)
DescriptionTribolium castaneum miR-11 stem-loop
Gene family MIPF0000252; mir-11
Stem-loop
   caaac  uuaca            -u           a      cc    u  g 
5'      gc     uuguaaaugcau  cugggauucug cuguga  ugug gu u
        ||     ||||||||||||  ||||||||||| ||||||  |||| || c
3'      cg     gacauuugcgua  gaucuugagac gacacu  acac ua u
   cucuu  --uuc            uc           g      --    u  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped45: 71290-71395 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11
tca-mir-11Unmapped45: 71290-71395 [+]
tca-mir-998Unmapped45: 71481-71576 [+]
Database links

Mature sequence tca-miR-11-5p

Accession MIMAT0018854
Sequence

27 - 

ugggauucugacugugaccugu

 - 48

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-11-3p

Accession MIMAT0018855
Sequence

63 - 

caucacaggcagaguucuagcu

 - 84

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).