Stem-loop sequence tca-mir-998

AccessionMI0016374 (change log)
DescriptionTribolium castaneum miR-998 stem-loop
Stem-loop
   gggac  --uuu    cu   u  ua      uu    u g     ugu 
5'      gc     gcca  acg ug  cugaau  caug g gcugc   u
        ||     ||||  ||| ||  ||||||  |||| | |||||    
3'      cg     uggu  ugc ac  gacuua  guac c cgaug   u
   ucaau  ucuau    -u   u  uc      gg    - a     cgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped45: 71481-71576 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-998
tca-mir-11Unmapped45: 71290-71395 [+]
tca-mir-998Unmapped45: 71481-71576 [+]
Database links

Mature sequence tca-miR-998-5p

Accession MIMAT0018852
Sequence

23 - 

uacugaauuucaugugggc

 - 41

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-998-3p

Accession MIMAT0018853
Sequence

54 - 

uagcaccaugggauucagcuca

 - 75

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).