Stem-loop sequence tca-mir-3877

AccessionMI0016371 (change log)
DescriptionTribolium castaneum miR-3877 stem-loop
Stem-loop
   gucaa       aaaaa   -            c 
5'      ccuucca     gca cucguuugguua u
        |||||||     ||| |||||||||||| a
3'      ggaaggu     ugu gagugaaccaau a
   agaga       --cac   u            a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 10960147-10960214 [-]
intergenic
Database links

Mature sequence tca-miR-3877-5p

Accession MIMAT0018846
Sequence

5 - 

accuuccaaaaaagcacuc

 - 23

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3877-3p

Accession MIMAT0018847
Sequence

39 - 

aaccaagugaguugucacuggaagg

 - 63

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).