Stem-loop sequence tca-mir-3876

AccessionMI0016370 (change log)
DescriptionTribolium castaneum miR-3876 stem-loop
Stem-loop
   uuucg               -ua   ccaa 
5'      uuuuauuuuaccacu   cua    g
        |||||||||||||||   |||     
3'      agaguaaaaugguga   gau    u
   aaaaa               cca   cagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 5394066-5394126 [+]
intergenic
Database links

Mature sequence tca-miR-3876-5p

Accession MIMAT0018844
Sequence

5 - 

guuuuauuuuaccacuuac

 - 23

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3876-3p

Accession MIMAT0018845
Sequence

36 - 

uagaccagugguaaaaugag

 - 55

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).