Stem-loop sequence tca-mir-3873

AccessionMI0016367 (change log)
DescriptionTribolium castaneum miR-3873 stem-loop
Stem-loop
   uuauu         -cga   uua       u       uua      ua   a   uuaaaa 
5'      aguuguugc    aug   uaagguu gcauucg   ggaaua  uua uug      c
        |||||||||    |||   ||||||| |||||||   ||||||  ||| |||       
3'      uuaauaaug    uac   auuuuaa uguaagu   ucuugu  aau aac      g
   ccaau         uuaa   ucg       -       ---      ua   a   cuaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 4215103-4215225 [-]
intergenic
Database links

Mature sequence tca-miR-3873-5p

Accession MIMAT0018838
Sequence

13 - 

gccgaauguuauaagguu

 - 30

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3873-3p

Accession MIMAT0018839
Sequence

89 - 

auguaauuuuagcucauaau

 - 108

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).