Stem-loop sequence tca-mir-3872

AccessionMI0016366 (change log)
DescriptionTribolium castaneum miR-3872 stem-loop
Stem-loop
   g   -a    u -uac  cc         ----   --u     u  gcg 
5'  uga  guga c    ag  agaaaugca    uua   uaugc cu   a
    |||  |||| |    ||  |||||||||    |||   ||||| ||    
3'  acu  uacu g    uc  uuuuuacgu    aau   auacg ga   a
   -   cg    u uuaa  au         uuuu   ucu     u  aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 14554402-14554494 [+]
intergenic
Database links

Mature sequence tca-miR-3872-5p

Accession MIMAT0018836
Sequence

2 - 

ugaagugaucuacagccagaaaugca

 - 27

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3872-3p

Accession MIMAT0018837
Sequence

66 - 

ugcauuuuuuacuaauuguucaugcu

 - 91

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).