Stem-loop sequence tca-mir-3869

AccessionMI0016363 (change log)
DescriptionTribolium castaneum miR-3869 stem-loop
Stem-loop
   uaauu        au         aa     a      
5'      acugauag  ggucucgaa  gccuu uagcg 
        ||||||||  |||||||||  ||||| |||| a
3'      ugauuguc  ccagagcuu  cgggg guugu 
   uccau        -c         -a     -      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 14293317-14293388 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3869
tca-mir-3869ChLG5: 14293317-14293388 [+]
tca-mir-3850ChLG5: 14293865-14294020 [-]
Database links

Mature sequence tca-miR-3869-5p

Accession MIMAT0018830
Sequence

6 - 

acugauagauggucucgaaaagcc

 - 29

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3869-3p

Accession MIMAT0018831
Sequence

48 - 

cauucgagaccccuguuaguuac

 - 70

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).