Stem-loop sequence tca-mir-3867

AccessionMI0016361 (change log)
DescriptionTribolium castaneum miR-3867 stem-loop
Stem-loop
   -ucc     u     ga  a a ug  -   a         ---   a 
5'     gcccc auaag  cc c g  ga agc gggaacggu   auc u
       ||||| |||||  || | |  || ||| |||||||||   ||| u
3'     ugggg uguuc  gg g c  uu uug cccuugcca   uag u
   gaca     -     gg  c a gu  a   -         cau   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 1218119-1218210 [+]
intergenic
Database links

Mature sequence tca-miR-3867-5p

Accession MIMAT0018826
Sequence

17 - 

ccacaguggaagcagggaacgguauc

 - 42

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3867-3p

Accession MIMAT0018827
Sequence

51 - 

uacaccguucccguuauuugcagcgg

 - 76

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).