Stem-loop sequence tca-mir-3866

AccessionMI0016360 (change log)
DescriptionTribolium castaneum miR-3866 stem-loop
Stem-loop
   guaau         --------      uu gauc     -   a  u 
5'      uuuuuuuuc        gcacag  u    aaucg gua cc u
        |||||||||        ||||||  |    ||||| ||| || g
3'      aaaagaagg        cguguc  a    uuggc cau gg a
   cgagu         uaauaaau      cu -aua     u   c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG4: 689556-689644 [-]
intergenic
Database links

Mature sequence tca-miR-3866-5p

Accession MIMAT0018824
Sequence

13 - 

ucgcacaguuugaucaaucgg

 - 33

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3866-3p

Accession MIMAT0018825
Sequence

44 - 

ggcuacucgguuauaauccugugcu

 - 68

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).