Stem-loop sequence tca-mir-750

AccessionMI0016358 (change log)
DescriptionTribolium castaneum miR-750 stem-loop
Literature search

1 open access papers mention tca-mir-750
(1 sentences)

Stem-loop
   agaaa     g    c   g       -         uc   ugau 
5'      gcaaa ggcc uug guggaag guuggaucu  gca    u
        ||||| |||| ||| ||||||| |||||||||  |||     
3'      cguuu cugg agu uaccuuc caaucuaga  cgu    c
   acaac     a    c   a       u         -c   ugaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG4: 9316826-9316917 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-750
tca-mir-750ChLG4: 9316826-9316917 [+]
tca-mir-1175ChLG4: 9316972-9317076 [+]
Database links

Mature sequence tca-miR-750-5p

Accession MIMAT0018820
Sequence

19 - 

ggguggaagguuggaucuucgcaug

 - 43

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-750-3p

Accession MIMAT0018821
Sequence

54 - 

ccagaucuaacucuuccauaugacg

 - 78

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).