Stem-loop sequence tca-mir-1175

AccessionMI0016357 (change log)
DescriptionTribolium castaneum miR-1175 stem-loop
Gene family MIPF0000715; mir-1175
Stem-loop
   cgcuu   u       ugu     a  -     c   g uc   u    uggu 
5'      uga cgagcuc   aaagu ag uggag agu g  ucu cacu    u
        ||| |||||||   ||||| || ||||| ||| |  ||| ||||     
3'      auu gcucgag   uuuua uc accuc uca c  aga guga    u
   gcaac   u       -uu     c  u     c   a uu   -    uauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG4: 9316972-9317076 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-1175
tca-mir-750ChLG4: 9316826-9316917 [+]
tca-mir-1175ChLG4: 9316972-9317076 [+]
Database links

Mature sequence tca-miR-1175-5p

Accession MIMAT0018818
Sequence

25 - 

aaguggagcaguggucucuucac

 - 47

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-1175-3p

Accession MIMAT0018819
Sequence

61 - 

ugagauucaacuccuccaucuc

 - 82

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).