Stem-loop sequence tca-mir-279e

AccessionMI0016356 (change log)
DescriptionTribolium castaneum miR-279e stem-loop
Literature search

2 open access papers mention tca-mir-279e
(8 sentences)

Stem-loop
   cggug      uc   -      c       a     uuguu     -   g 
5'      gagcuc  ggu guaagc aguguuc gucua     ucaca uug u
        ||||||  ||| |||||| ||||||| |||||     ||||| |||  
3'      uuuggg  cca cguucg ucacaag uagau     agugu agc u
   ----g      -u   a      c       c     ----c     u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 11200-11294 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-279e
tca-mir-279eChLG9: 11200-11294 [-]
tca-mir-9eChLG9: 11062-11172 [-]
tca-mir-2944cChLG9: 10955-11064 [-]
Database links

Mature sequence tca-miR-279e-5p

Accession MIMAT0018816
Sequence

21 - 

gccaguguucagucuauuguuuca

 - 44

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-279e-3p

Accession MIMAT0018817
Sequence

60 - 

ugacuagaucgaacacucgcuugc

 - 83

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).