Stem-loop sequence tca-mir-3865

AccessionMI0016355 (change log)
DescriptionTribolium castaneum miR-3865 stem-loop
Stem-loop
   uccaa          uaauaaauuaa      --au  uga          gcc 
5'      aauuguuuuu           ggcaag    cu   gcuggugugu   g
        ||||||||||           ||||||    ||   ||||||||||   u
3'      uuaauaaaga           ccguuc    gg   ugaccacacg   u
   -----          ---uaaaaaga      cuuu  -ug          auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 14430866-14430965 [-]
intergenic
Database links

Mature sequence tca-miR-3865-5p

Accession MIMAT0018814
Sequence

26 - 

aggcaagaucuugagcug

 - 43

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3865-3p

Accession MIMAT0018815
Sequence

56 - 

uuagcacaccagugugguuuccuugc

 - 81

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).