Stem-loop sequence tca-mir-3864

AccessionMI0016354 (change log)
DescriptionTribolium castaneum miR-3864 stem-loop
Stem-loop
   aguga   ggg         -gcau     -          
5'      ugu   gcgacauag     gguuu gaguuuguu 
        |||   |||||||||     ||||| |||||||| u
3'      aua   cgcuguauc     ccaaa uucaaauaa 
   gauua   aga         auccu     g          
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 8929305-8929383 [-]
intergenic
Database links

Mature sequence tca-miR-3864-5p

Accession MIMAT0018812
Sequence

11 - 

ggcgacauaggcaugguuugaguuug

 - 36

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3864-3p

Accession MIMAT0018813
Sequence

48 - 

ugaaaccuccuacuaugucgc

 - 68

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).