Stem-loop sequence tca-mir-2944c

AccessionMI0016353 (change log)
DescriptionTribolium castaneum miR-2944c stem-loop
Gene family MIPF0001335; mir-2944
Stem-loop
   gccga    cac  a         gc   a   -    u    -          auu 
5'      gcga   uc gggaaucug  uug agg aacu cugg ugugauaugu   u
        ||||   || |||||||||  ||| ||| |||| |||| ||||||||||    
3'      cguu   ag cccuugggu  agc ucc uuga gacc acacuauaua   a
   gacaa    ---  -         aa   a   a    u    g          acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 10955-11064 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-2944c
tca-mir-279eChLG9: 11200-11294 [-]
tca-mir-9eChLG9: 11062-11172 [-]
tca-mir-2944cChLG9: 10955-11064 [-]
Database links

Mature sequence tca-miR-2944c-5p

Accession MIMAT0018810
Sequence

29 - 

gaaggaacuucuggugugauaug

 - 51

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-2944c-3p

Accession MIMAT0018811
Sequence

64 - 

uaucacagccaguaguuacc

 - 83

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).