Stem-loop sequence tca-mir-3863

AccessionMI0016352 (change log)
DescriptionTribolium castaneum miR-3863 stem-loop
Stem-loop
   ugcca      ga     u            c    u    uuuga 
5'      gggugu  agaau gaucaaguagcg cgcu gguc     a
        ||||||  ||||| |||||||||||| |||| ||||      
3'      ccuacg  ucuua cuaguucguugc gcga cuag     u
   uaaca      uc     c            u    -    uuagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 13734623-13734715 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3863
tca-mir-3862ChLG9: 13734517-13734606 [+]
tca-mir-3863ChLG9: 13734623-13734715 [+]
Database links

Mature sequence tca-miR-3863-5p

Accession MIMAT0018808
Sequence

19 - 

ugaucaaguagcgccgcuugguc

 - 41

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3863-3p

Accession MIMAT0018809
Sequence

56 - 

ucagcgucguugcuugauccau

 - 77

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).