Stem-loop sequence tca-mir-252b

AccessionMI0016351 (change log)
DescriptionTribolium castaneum miR-252b stem-loop
Literature search

1 open access papers mention tca-mir-252b
(4 sentences)

Stem-loop
   gccuc ug    cc      u         c     a  u   guu 
5'      u  ucca  cgguau aaguaguug gccga gg gau   u
        |  ||||  |||||| ||||||||| ||||| || |||   u
3'      a  aggu  gccaua uucgucggu uggcu cc cua   u
   cuaaa gu    ac      u         c     -  u   aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 6629979-6630072 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-252b
tca-mir-252bChLG9: 6629979-6630072 [+]
tca-mir-252aChLG9: 6637894-6637980 [+]
Database links

Mature sequence tca-miR-252b-5p

Accession MIMAT0018806
Sequence

20 - 

uuaaguaguugcgccgaaggu

 - 40

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-252b-3p

Accession MIMAT0018807
Sequence

56 - 

uccucggucuggcugcuuua

 - 75

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).