Stem-loop sequence tca-mir-252a

AccessionMI0016350 (change log)
DescriptionTribolium castaneum miR-252a stem-loop
Gene family MIPF0000285; mir-252
Literature search

1 open access papers mention tca-mir-252a
(4 sentences)

Stem-loop
   aaaga    -      ac        a u  c       ua a 
5'      cugu ccuguu  uaaguacu g gc gcaggag  c u
        |||| ||||||  |||||||| | || |||||||  |  
3'      gaca ggguaa  auucguga c cg cguccuc  g u
   aguaa    c      cu        a u  u       ca c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 6637894-6637980 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-252a
tca-mir-252bChLG9: 6629979-6630072 [+]
tca-mir-252aChLG9: 6637894-6637980 [+]
Database links

Mature sequence tca-miR-252a-5p

Accession MIMAT0018804
Sequence

17 - 

cuaaguacuagugccgcagg

 - 36

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-252a-3p

Accession MIMAT0018805
Sequence

51 - 

ccugcugcucaagugcuuauc

 - 71

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).