Stem-loop sequence tca-mir-3862

AccessionMI0016348 (change log)
DescriptionTribolium castaneum miR-3862 stem-loop
Stem-loop
   ugcaa     cu    a  gg       uc          u  u 
5'      gguug  cgaa uu  gcaaaag  cgccugaaca uu u
        |||||  |||| ||  |||||||  |||||||||| ||  
3'      ccaac  guuu ag  cguuuuc  gcggacuugu aa c
   caaca     cg    c  ua       uc          u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 13734517-13734606 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3862
tca-mir-3862ChLG9: 13734517-13734606 [+]
tca-mir-3863ChLG9: 13734623-13734715 [+]
Database links

Mature sequence tca-miR-3862-5p

Accession MIMAT0018800
Sequence

19 - 

ugggcaaaaguccgccugaaca

 - 40

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3862-3p

Accession MIMAT0018801
Sequence

53 - 

uucaggcgcucuuuugcaugac

 - 74

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).