Stem-loop sequence tca-mir-2788

AccessionMI0016347 (change log)
DescriptionTribolium castaneum miR-2788 stem-loop
Gene family MIPF0001204; mir-2788
Stem-loop
   gacau     u     au            u  c      u  cucaa 
5'      uuguu augca  uuugggguuucu ag ggcauu gc     a
        ||||| |||||  |||||||||||| || |||||| ||     u
3'      agcag uacgu  aaacccuaaagg uc ccguaa cg     u
   aacuc     -     ac            u  -      -  ucaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG8: 4706940-4707035 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-2788
tca-mir-193ChLG8: 4707070-4707166 [-]
tca-mir-2788ChLG8: 4706940-4707035 [-]
Database links

Mature sequence tca-miR-2788-5p

Accession MIMAT0018798
Sequence

21 - 

ugggguuucuuagcggcauuu

 - 41

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-2788-3p

Accession MIMAT0018799
Sequence

58 - 

caaugcccuuggaaauccc

 - 76

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).