Stem-loop sequence tca-mir-3861

AccessionMI0016346 (change log)
DescriptionTribolium castaneum miR-3861 stem-loop
Stem-loop
   guuua u ug         gua uu          uu             uuu 
5'      g g  uuucgaagg   c  aauggaauua  ugguaucaauuga   u
        | |  |||||||||   |  ||||||||||  |||||||||||||    
3'      c u  aaagcuuuu   g  uuaccuuaau  accaugguuaauu   c
   gugua u gu         aag cu          uu             uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG8: 4424522-4424629 [-]
intergenic
Database links

Mature sequence tca-miR-3861-5p

Accession MIMAT0018796
Sequence

27 - 

auggaauuauuugguauc

 - 44

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3861-3p

Accession MIMAT0018797
Sequence

63 - 

uugguaccauuuaauuccauuucg

 - 86

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).