Stem-loop sequence tca-mir-375

AccessionMI0016345 (change log)
DescriptionTribolium castaneum miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

1 open access papers mention tca-mir-375
(2 sentences)

Stem-loop
   ucaaa            u         u  -  aau 
5'      cugacuugagcc ugcgaauaa uc cu   u
        |||||||||||| ||||||||| || ||   u
3'      gauugagcucgg gugcuuguu ag ga   a
   aaaua            u         u  c  gaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG8: 12770476-12770549 [-]
intergenic
Database links

Mature sequence tca-miR-375-5p

Accession MIMAT0018794
Sequence

9 - 

acuugagccuugcgaauaa

 - 27

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-375-3p

Accession MIMAT0018795
Sequence

47 - 

uuuguucguguggcucgaguua

 - 68

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).