Stem-loop sequence tca-mir-3860

AccessionMI0016344 (change log)
DescriptionTribolium castaneum miR-3860 stem-loop
Stem-loop
   uagua      gacga   aa     u    uu 
5'      gcacug     ucu  acaug cuuc  u
        ||||||     |||  ||||| ||||   
3'      cgugac     gga  ugugu gaag  a
   uaaaa      --aaa   aa     u    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 1491181-1491246 [-]
intergenic
Database links

Mature sequence tca-miR-3860-5p

Accession MIMAT0018792
Sequence

4 - 

uagcacuggacgaucuaa

 - 21

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3860-3p

Accession MIMAT0018793
Sequence

42 - 

uuguguaaaggaaacagugca

 - 62

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).