Stem-loop sequence tca-mir-3859

AccessionMI0016343 (change log)
DescriptionTribolium castaneum miR-3859 stem-loop
Stem-loop
   cacac      cauuua   cg   g      guc 
5'      cccaca      agc  gcc uuucau   u
        ||||||      |||  ||| ||||||    
3'      gggugu      ucg  ugg gaagua   u
   uacaa      ---ugc   ug   a      aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 11854759-11854827 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3859
tca-mir-11627ChLG7: 11855707-11855798 [-]
tca-mir-3859ChLG7: 11854759-11854827 [-]
Database links

Mature sequence tca-miR-3859-5p

Accession MIMAT0018790
Sequence

4 - 

accccacacauuuaagcc

 - 21

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3859-3p

Accession MIMAT0018791
Sequence

43 - 

gaagaggugugcucguuguggg

 - 64

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).