Stem-loop sequence tca-mir-279d

AccessionMI0016342 (change log)
DescriptionTribolium castaneum miR-279d stem-loop
Gene family MIPF0000184; mir-279
Literature search

2 open access papers mention tca-mir-279d
(8 sentences)

Stem-loop
   aucaa    -   --------     aaaccaa       a  g   u     u             c   -   u 
5'      gagu ggc        cccaa       ugaaaac cu ugu ggcga uguggguuuaguc acg uuu a
        |||| |||        |||||       ||||||| || ||| ||||| ||||||||||||| ||| |||  
3'      cuca ccg        ggguu       auuuuug ga aua cugcu auaccuagaucag ugc aaa g
   accuc    a   aacacccc     cagcacg       -  g   u     c             -   c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 7543987-7544128 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-279d
tca-mir-279aChLG7: 7544158-7544222 [-]
tca-mir-279dChLG7: 7543987-7544128 [-]
Database links

Mature sequence tca-miR-279d-5p

Accession MIMAT0018788
Sequence

39 - 

uggcgauuguggguuuaguccacg

 - 62

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-279d-3p

Accession MIMAT0018789
Sequence

76 - 

ugacuagauccauacucgucuauag

 - 100

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).