Stem-loop sequence tca-mir-92c

AccessionMI0016341 (change log)
DescriptionTribolium castaneum miR-92c stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention tca-mir-92c
(7 sentences)

Stem-loop
   uuua   -        --  a  --a     c  u    ug     u    u      a    uuau 
5'     cuu aacauuuu  cg gg   uggaa gg cggu  ggucg gauu gugcaa uaug    u
       ||| ||||||||  || ||   ||||| || ||||  ||||| |||| |||||| ||||     
3'     gag uugugggg  gc cc   accuu uc guca  ccggc cuga cacguu auac    u
   -agg   g        cc  a  agg     c  -    gu     c    c      -    uugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 1764467-1764594 [+]
intergenic
Database links

Mature sequence tca-miR-92c-5p

Accession MIMAT0018786
Sequence

36 - 

gggucgugauuugugcaaa

 - 54

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-92c-3p

Accession MIMAT0018787
Sequence

71 - 

uauugcaccagucccggccugac

 - 93

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).