Stem-loop sequence tca-mir-3858

AccessionMI0016339 (change log)
DescriptionTribolium castaneum miR-3858 stem-loop
Stem-loop
       u    u       -  uuu       ggcc 
5' guuu uuag gaagcga ag   uuucauu    a
   |||| |||| ||||||| ||   |||||||    a
3' uaaa aauc cuucguu uc   aaaguaa    u
       u    u       c  -uc       aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 8929084-8929152 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3858
tca-mir-11624dChLG6: 8930530-8930621 [-]
tca-mir-3851eChLG6: 8930351-8930445 [-]
tca-mir-3851d-2ChLG6: 8930246-8930336 [-]
tca-mir-3858a-2ChLG6: 8930130-8930244 [-]
tca-mir-11624b-2ChLG6: 8929472-8929532 [-]
tca-mir-3851fChLG6: 8929279-8929373 [-]
tca-mir-3851hChLG6: 8929175-8929264 [-]
tca-mir-3858ChLG6: 8929084-8929152 [-]
Database links

Mature sequence tca-miR-3858-5p

Accession MIMAT0018782
Sequence

8 - 

agugaagcgaaguuuuuuc

 - 26

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3858-3p

Accession MIMAT0018783
Sequence

43 - 

ugaaacucucuugcuucucuaa

 - 64

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).