Stem-loop sequence tca-mir-3851e

AccessionMI0016338 (change log)
DescriptionTribolium castaneum miR-3851e stem-loop
Gene family MIPF0001201; mir-3851
Stem-loop
   u       -    -gc  cgc            u         guuuuu 
5'  guuugaa uuug   gc   guugauuuggag cguacuaug      g
    ||||||| ||||   ||   |||||||||||| |||||||||       
3'  uaaauuu aaac   ug   cagcuaagccuu gcaugauac      g
   -       u    aau  -au            -         acucau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 8930351-8930445 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3851e
tca-mir-11624dChLG6: 8930530-8930621 [-]
tca-mir-3851eChLG6: 8930351-8930445 [-]
tca-mir-3851d-2ChLG6: 8930246-8930336 [-]
tca-mir-3858a-2ChLG6: 8930130-8930244 [-]
tca-mir-11624b-2ChLG6: 8929472-8929532 [-]
tca-mir-3851fChLG6: 8929279-8929373 [-]
tca-mir-3851hChLG6: 8929175-8929264 [-]
tca-mir-3858ChLG6: 8929084-8929152 [-]
Database links

Mature sequence tca-miR-3851e-5p

Accession MIMAT0018780
Sequence

19 - 

cguugauuuggagucguacuaug

 - 41

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3851e-3p

Accession MIMAT0018781
Sequence

58 - 

uaguacguuccgaaucgacuag

 - 79

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).