Stem-loop sequence tca-mir-3851d-1

AccessionMI0016337 (change log)
DescriptionTribolium castaneum miR-3851d-1 stem-loop
Gene family MIPF0001201; mir-3851
Stem-loop
   aauua      a        g        g g        uaauu 
5'      aauuua uauugagu gacauggg u guacugug     u
        |||||| |||||||| |||||||| | ||||||||      
3'      uuaaau augacucg uuguaccc g caugauac     u
   uuaca      a        g        - g        ccagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 8819480-8819570 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3851d-1
tca-mir-3851g-3ChLG6: 8825859-8825916 [+]
tca-mir-3851cChLG6: 8825723-8825833 [+]
tca-mir-11624cChLG6: 8825488-8825579 [+]
tca-mir-11626bChLG6: 8825341-8825447 [+]
tca-mir-11624b-1ChLG6: 8819743-8819834 [-]
tca-mir-3851d-1ChLG6: 8819480-8819570 [-]
Database links

Mature sequence tca-miR-3851d-5p

Accession MIMAT0037388
Sequence

18 - 

aguggacauggggugguacugu

 - 39

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

Mature sequence tca-miR-3851d-3p

Accession MIMAT0018779
Sequence

55 - 

uaguacggcccauguuggcuc

 - 75

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).
2
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).