Stem-loop sequence tca-mir-3049

AccessionMI0016336 (change log)
DescriptionTribolium castaneum miR-3049 stem-loop
Literature search

1 open access papers mention tca-mir-3049
(2 sentences)

Stem-loop
   augug   g      acga    gag    g  g -agg acauggg     c    g    c     ga    ugc         c uu 
5'      gug aacgau    uggu   uggg gc c    g       ggcgc acau gggu gggaa  cagu   ggcggauuu g  u
        ||| ||||||    ||||   |||| || |    |       ||||| |||| |||| |||||  ||||   ||||||||| |   
3'      cau uuguug    aucg   acuc cg g    c       ccgug ugug cccg cccuu  gucg   uugccugaa c  u
   ----a   -      gagg    --g    g  g ggaa gacggag     c    g    a     ac    --c         - uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 4999022-4999192 [+]
intergenic
Database links

Mature sequence tca-miR-3049-5p

Accession MIMAT0018776
Sequence

61 - 

ucgggaagacaguugcggcgga

 - 82

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3049-3p

Accession MIMAT0018777
Sequence

98 - 

uccguucgcugcauuccc

 - 115

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).