Stem-loop sequence tca-mir-3857

AccessionMI0016335 (change log)
DescriptionTribolium castaneum miR-3857 stem-loop
Stem-loop
   agaac     a   g         u  c    u  uau  -   g    g a 
5'      gagaa uug gcuguggug gc uuga ac   cc cac uguu c g
        ||||| ||| ||||||||| || |||| ||   || ||| |||| | g
3'      cuuuu aac cgguacuac cg aacu ug   gg gug acaa g a
   guaua     -   g         u  u    c  --u  u   g    g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 8180983-8181085 [+]
intergenic
Database links

Mature sequence tca-miR-3857-5p

Accession MIMAT0018774
Sequence

23 - 

ugugccuugauacuaucccacgu

 - 45

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3857-3p

Accession MIMAT0018775
Sequence

61 - 

agguguggugucucaaugcuc

 - 81

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).