Stem-loop sequence tca-mir-3851c

AccessionMI0016334 (change log)
DescriptionTribolium castaneum miR-3851c stem-loop
Gene family MIPF0001201; mir-3851
Stem-loop
   ccgga     cau       gc c               u         -  uuu 
5'      cgaau   gaauuug  g cgaguugauuuggag cguacuaug gu   u
        |||||   |||||||  | ||||||||||||||| ||||||||| ||   g
3'      gcuua   uuuaaac  u gcucagcuaagccuu gcaugauac cg   g
   uaaca     aau       aa u               -         a  cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 8825723-8825833 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3851c
tca-mir-3851d-1ChLG6: 8819480-8819570 [-]
tca-mir-11624b-1ChLG6: 8819743-8819834 [-]
tca-mir-11626bChLG6: 8825341-8825447 [+]
tca-mir-11624cChLG6: 8825488-8825579 [+]
tca-mir-3851cChLG6: 8825723-8825833 [+]
tca-mir-3851g-3ChLG6: 8825859-8825916 [+]
Database links

Mature sequence tca-miR-3851c-5p

Accession MIMAT0018772
Sequence

27 - 

aguugauuuggagucguacu

 - 46

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3851c-3p

Accession MIMAT0018773
Sequence

66 - 

uaguacguuccgaaucgacucg

 - 87

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).