Stem-loop sequence tca-mir-3856

AccessionMI0016333 (change log)
DescriptionTribolium castaneum miR-3856 stem-loop
Stem-loop
   gugug uu         --           --------     cu 
5'      g  uuuuugcaa  gaaagucauuu        gaaca  u
        |  |||||||||  |||||||||||        |||||  u
3'      c  aaaggcguu  uuuuuagugag        uuugu  c
   cugaa uu         gc           ucaaacgc     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 2817630-2817712 [+]
intergenic
Database links

Mature sequence tca-miR-3856-5p

Accession MIMAT0018770
Sequence

13 - 

ugcaagaaagucauuugaa

 - 31

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3856-3p

Accession MIMAT0018771
Sequence

55 - 

agugauuuuucguugcggaa

 - 74

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).