Stem-loop sequence tca-mir-87b

AccessionMI0016332 (change log)
DescriptionTribolium castaneum miR-87b stem-loop
Gene family MIPF0000152; mir-87
Stem-loop
   ----c      ugccugcc               -        uu    ugca 
5'      ggggga        gucgacacgcuugaa cuuuguuu  ccug    u
        ||||||        ||||||||||||||| ||||||||  ||||     
3'      cucucu        caguuguguggacuu gaaacgag  ggau    u
   gacua      ----caau               a        -u    cuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 1654265-1654362 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-87b
tca-mir-87aChLG6: 1651407-1651488 [+]
tca-mir-87bChLG6: 1654265-1654362 [+]
Database links

Mature sequence tca-miR-87b-5p

Accession MIMAT0018768
Sequence

22 - 

acgcuugaacuuuguuuuuccu

 - 43

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-87b-3p

Accession MIMAT0018769
Sequence

58 - 

gugagcaaagauucagguguguug

 - 81

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).