Stem-loop sequence tca-mir-3854

AccessionMI0016329 (change log)
DescriptionTribolium castaneum miR-3854 stem-loop
Stem-loop
   cgaca       - cc   u    -      gcau 
5'      ccacaau c  agc ccac auuauu    u
        ||||||| |  ||| |||| ||||||     
3'      gguguua g  uug ggug uaauaa    u
   uuaaa       u au   c    a      aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 2503217-2503286 [-]
intergenic
Database links

Mature sequence tca-miR-3854-5p

Accession MIMAT0018764
Sequence

5 - 

accacaaucccagcuccac

 - 23

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3854-3p

Accession MIMAT0018765
Sequence

45 - 

uaguggcguuuaguauugugg

 - 65

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).