Stem-loop sequence tca-mir-3853

AccessionMI0016328 (change log)
DescriptionTribolium castaneum miR-3853 stem-loop
Stem-loop
   uu  -    a   a        ug   cu  u          u    u    u   u 
5'   uc auga aaa uauccuug  cau  ug guguauuuug gaaa gcua agu g
     || |||| ||| ||||||||  |||  || |||||||||| |||| |||| ||| a
3'   gg uauu uuu gugggaac  gua  ac cguauaaaac uuuu ugau uua a
   -u  c    g   a        gu   au  u          u    u    u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 5820881-5820995 [-]
intergenic
Database links

Mature sequence tca-miR-3853-5p

Accession MIMAT0018762
Sequence

30 - 

guguguauuuugugaaaugcua

 - 51

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3853-3p

Accession MIMAT0018763
Sequence

67 - 

guuuuuuucaaaauaugcuca

 - 87

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).