Stem-loop sequence tca-mir-3852

AccessionMI0016327 (change log)
DescriptionTribolium castaneum miR-3852 stem-loop
Stem-loop
   --cuccaugacgucacacuc         ----   c uu       uc 
5'                     uuaauacgg    ggc u  aaggagu  u
                       |||||||||    ||| |  |||||||   
3'                     aauuauguu    ccg g  uucuucg  g
   cagcaacgcaguggcgcuau         aaua   c uc       gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 14767953-14768046 [-]
intergenic
Database links

Mature sequence tca-miR-3852-5p

Accession MIMAT0018760
Sequence

24 - 

acggggccuuuaaggagu

 - 41

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3852-3p

Accession MIMAT0018761
Sequence

51 - 

ucuucugcgccauaauugua

 - 70

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).