Stem-loop sequence tca-mir-3851a-1

AccessionMI0016326 (change log)
DescriptionTribolium castaneum miR-3851a-1 stem-loop
Gene family MIPF0001201; mir-3851
Literature search

1 open access papers mention tca-mir-3851a-1
(1 sentences)

Stem-loop
   cggac     a        gc c                a        guuuug 
5'      gaauu ugaauuug  g cgaguugauuuggagu guacuaug      g
        ||||| ||||||||  | |||||||||||||||| ||||||||       
3'      cuuaa auuuaaac  u gcucagcuaagccuua caugauac      g
   aacaa     -        aa u                -        acucau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 235959-236066 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3851a-1
tca-mir-11624a-3ChLG5: 236198-236302 [-]
tca-mir-3851a-1ChLG5: 235959-236066 [-]
tca-mir-11624a-2ChLG5: 235784-235922 [-]
tca-mir-3851bChLG5: 235562-235669 [-]
tca-mir-3851g-2ChLG5: 235471-235547 [-]
Database links

Mature sequence tca-miR-3851a-5p

Accession MIMAT0018758
Sequence

26 - 

aguugauuuggaguaguacuaug

 - 48

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3851a-3p

Accession MIMAT0018759
Sequence

65 - 

uaguacauuccgaaucgacucg

 - 86

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).