Stem-loop sequence tca-mir-3851b

AccessionMI0016325 (change log)
DescriptionTribolium castaneum miR-3851b stem-loop
Gene family MIPF0001201; mir-3851
Stem-loop
   cggac    ca        auu  a            gua        - u  u 
5'      gaau  uaaauuug   ac aguugauuugga   guacuaug g gu u
        ||||  ||||||||   || ||||||||||||   |||||||| | || g
3'      cuua  auuuaaac   ug ucaacuaagccu   caugauac c ca g
   aacaa    -a        aau  c            -ug        a u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 235562-235669 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3851b
tca-mir-11624a-3ChLG5: 236198-236302 [-]
tca-mir-3851a-1ChLG5: 235959-236066 [-]
tca-mir-11624a-2ChLG5: 235784-235922 [-]
tca-mir-3851bChLG5: 235562-235669 [-]
tca-mir-3851g-2ChLG5: 235471-235547 [-]
Database links

Mature sequence tca-miR-3851b-5p

Accession MIMAT0018756
Sequence

26 - 

aguugauuuggaguaguacuaug

 - 48

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3851b-3p

Accession MIMAT0018757
Sequence

65 - 

uaguacguuccgaaucaacucg

 - 86

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).