Stem-loop sequence tca-mir-3849

AccessionMI0016323 (change log)
DescriptionTribolium castaneum miR-3849 stem-loop
Stem-loop
   guaac         u c         aac             uuuau 
5'      uguucgaaa g ugacauuuu   cauagugcuguug     a
        ||||||||| | |||||||||   |||||||||||||     u
3'      acaagcuuu c gcuguaaag   guguuacgauaau     u
   aucaa         u u         guu             uaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 5383152-5383248 [+]
intergenic
Database links

Mature sequence tca-miR-3849-5p

Accession MIMAT0018752
Sequence

18 - 

ugacauuuuaaccauagugcu

 - 38

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3849-3p

Accession MIMAT0018753
Sequence

60 - 

agcauuguguuggaaaugucguc

 - 82

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).