Stem-loop sequence tca-mir-309a

AccessionMI0016322 (change log)
DescriptionTribolium castaneum miR-309a stem-loop
Literature search

2 open access papers mention tca-mir-309a
(15 sentences)

Stem-loop
   aaaac     -u     a  ug    c       c     auaa 
5'      gcuaa  cuguu ga  aacu gacucgg ugaug    a
        |||||  ||||| ||  |||| ||||||| |||||     
3'      cgauu  gguaa cu  uuga uuggguc acuac    a
   aaaau     uu     c  gu    c       -     aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 7174273-7174360 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-309a
tca-mir-9dChLG5: 7174040-7174132 [+]
tca-mir-2944bChLG5: 7174149-7174250 [+]
tca-mir-309aChLG5: 7174273-7174360 [+]
tca-mir-3893ChLG5: 7175554-7175633 [+]
tca-mir-309cChLG5: 7175649-7175737 [+]
tca-mir-309bChLG5: 7175766-7175855 [+]
tca-mir-3791ChLG5: 7175867-7175951 [+]
Database links

Mature sequence tca-miR-309a-5p

Accession MIMAT0018750
Sequence

17 - 

agaugaacucgacucggcu

 - 35

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-309a-3p

Accession MIMAT0018751
Sequence

52 - 

ucacuggguucaguuuguccaaug

 - 75

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).