Stem-loop sequence tca-mir-9d

AccessionMI0016321 (change log)
DescriptionTribolium castaneum miR-9d stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention tca-mir-9d
(3 sentences)

Stem-loop
   aauac   u   u                -    a   -      aac 
5'      guc acu uauauuucuuugguga ucua cuu augauu   u
        ||| ||| |||||||||||||||| |||| ||| ||||||   u
3'      cgg ugg guauaaagaaaccacu agau gaa uacuga   u
   ----a   u   u                u    c   a      aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 7174040-7174132 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-9d
tca-mir-9dChLG5: 7174040-7174132 [+]
tca-mir-2944bChLG5: 7174149-7174250 [+]
tca-mir-309aChLG5: 7174273-7174360 [+]
tca-mir-3893ChLG5: 7175554-7175633 [+]
tca-mir-309cChLG5: 7175649-7175737 [+]
tca-mir-309bChLG5: 7175766-7175855 [+]
tca-mir-3791ChLG5: 7175867-7175951 [+]
Database links

Mature sequence tca-miR-9d-5p

Accession MIMAT0018748
Sequence

21 - 

cuuuggugaucuaacuuauga

 - 41

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-9d-3p

Accession MIMAT0018749
Sequence

57 - 

auaaagcuagauucaccaaag

 - 77

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).