Stem-loop sequence tca-mir-2944b

AccessionMI0016320 (change log)
DescriptionTribolium castaneum miR-2944b stem-loop
Gene family MIPF0001335; mir-2944
Stem-loop
   acuuc        u      uu     -      a g          gauu 
5'      auuucgca aaugca  uaagg aacuac g ugugaugugu    u
        |||||||| ||||||  ||||| |||||| | ||||||||||    c
3'      uaaagugu uuaugu  auucc uugaug c acacuaugca    a
   aacuc        -      -c     g      c g          aauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 7174149-7174250 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-2944b
tca-mir-9dChLG5: 7174040-7174132 [+]
tca-mir-2944bChLG5: 7174149-7174250 [+]
tca-mir-309aChLG5: 7174273-7174360 [+]
tca-mir-3893ChLG5: 7175554-7175633 [+]
tca-mir-309cChLG5: 7175649-7175737 [+]
tca-mir-309bChLG5: 7175766-7175855 [+]
tca-mir-3791ChLG5: 7175867-7175951 [+]
Database links

Mature sequence tca-miR-2944b-5p

Accession MIMAT0018746
Sequence

23 - 

uaaggaacuacaggugugaugug

 - 45

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-2944b-3p

Accession MIMAT0018747
Sequence

61 - 

uaucacagccguaguugccuuac

 - 83

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).