Stem-loop sequence tca-mir-3848

AccessionMI0016319 (change log)
DescriptionTribolium castaneum miR-3848 stem-loop
Stem-loop
   uauua   gc    -    gc       a    ---        u 
5'      ucc  ucua ugua  gguauau aggu   uagcgcgc g
        |||  |||| ||||  ||||||| ||||   |||||||| a
3'      agg  aggu acau  ucgugua uuca   auugugcg c
   -uuaa   -a    u    --       a    ccc        c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 6918155-6918239 [-]
intergenic
Database links

Mature sequence tca-miR-3848-5p

Accession MIMAT0018744
Sequence

16 - 

guagcgguauauaagguua

 - 34

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3848-3p

Accession MIMAT0018745
Sequence

51 - 

uuacccacuuaaugugcuua

 - 70

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).