Stem-loop sequence tca-mir-3847

AccessionMI0016318 (change log)
DescriptionTribolium castaneum miR-3847 stem-loop
Stem-loop
   gaagu    u     u        uuuauuu       ca       c 
5'      gcug uuaaa ucgaacuu       aauuugg  augugug g
        |||| ||||| ||||||||       |||||||  ||||||| a
3'      cggc aauuu agcuugga       uuaagcu  ugcacau g
   aaauu    c     u        -cuagcu       -c       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 1617960-1618056 [-]
intergenic
Database links

Mature sequence tca-miR-3847-5p

Accession MIMAT0018742
Sequence

16 - 

uucgaacuuuuuauuuaauuu

 - 36

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3847-3p

Accession MIMAT0018743
Sequence

60 - 

cucgaauuucgaucagguu

 - 78

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).