Stem-loop sequence tca-mir-3846

AccessionMI0016317 (change log)
DescriptionTribolium castaneum miR-3846 stem-loop
Stem-loop
   ---   aua      c  -    ------       a  aa   uucuu   uuauaa  cu     -    g 
5'    gga   gaguua uu ccau      ugaugau gu  aug     ggc      gu  uugug ucaa a
      |||   |||||| || ||||      ||||||| ||  |||     |||      ||  ||||| |||| a
3'    ccu   cuuaau aa ggua      acuacug ca  uac     ccg      ca  aacac aguu u
   uaa   ---      c  c    caguca       -  gc   uaacu   ---uug  uu     c    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 15911874-15912004 [-]
intergenic
Database links

Mature sequence tca-miR-3846-5p

Accession MIMAT0018740
Sequence

33 - 

uguucuuggcuuauaagucuuugugu

 - 58

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3846-3p

Accession MIMAT0018741
Sequence

68 - 

ugaccacaauuacguugccuca

 - 89

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).